INTRODUCTION

Green marine algal genus Ulva Linnaeus (Ulvales) is a commonly abundant inhabitant of marine, estuarine and freshwater habitats worldwide and often causes harmful blooms in eutrophic estuaries and bays (Fletcher 1996). About 120 species are currently accepted in this genus (Guiry and Guiry 2017). Those species exhibit a simple thallus structure along with a lack of differentiated reproductive organs (Bliding 1963, 1968; Womersley 1984; Phillips 1988; Blomster et al. 1998, 1999; Hayden and Waaland 2004), which makes it difficult to identify the species. Moreover, the taxonomy of the genus is further complicated by the significant intraspecific variation and interspecific overlap in the relatively few morphological and anatomical characters that occurred in response to the varying conditions of the habitat environments (Tanner 1979, 1986; Phillips 1988; Malta et al. 1999).

For these, the molecular data, such as the nuclear internal transcribed spacer (ITS) and plastid ribulose-1, 5-bisphosphate carboxylase/oxygenase (rbcL), have been used to delineate the species within the genus and phylogenetic analyses (Blomster et al. 1998, 1999; Shimada et al. 2008; Hofmann et al. 2010; Mares et al. 2011; Ogawa et al. 2013).

Seventeen species in Ulva are currently recorded in the marine algal flora of Korea (Lee and Kang 1986, 2002; Lee 2008; Bae 2010; Kim et al. 2013; Lee et al. 2014). During a survey of marine algal flora, a species of Ulva was collected from Imgok, which is located on the eastern coast of Korea. Based on morphological and molecular analyses conducted in the current study, it was identified as U. torta which is a newly recorded in marine algal flora of Korea.

MATERIALS AND METHODS

For the current study, samples were collected from Imgok, which is on the eastern coast of Korea. A part of the samples was preserved in 5% formalin seawater, and the others were made as herbarium specimens. A portion of the material was dried, and preserved in silica gel for DNA extraction. Sections of the thallus were mounted in 30% corn syrup for permanent preparation. The extraction of total genomic DNA was made by using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the usual protocol. The extracted DNA was assessed by using a gel electrophoresis on a 1% agarose gel and used for amplification of the internal transcribed spacer (ITS) and Ribulose-1, 5-bisphosphate carboxylase/oxygenase (rbcL) regions by means of published primers (Ogawa et al. 2013). The primer sequences were as follows: ITS primer (F: 5′ TCTTTGAAACCG TATCGTGA 3′ R: 5′ GGTGAACCTGCGGAGGGAT 3′) and rbcL primer (F: 5′ TGTTTACGAGGTGGTCTTGA 3′, R: 5′ TCAAGACCACCTCGTAAACA 3′) (Hayakawa et al. 2012). PCR amplifications were performed in a TaKaRa PCR Thermal Cycler Dice (TaKaRa Bio Inc., Otsu, Japan) with an initial denaturation step at 94°C for 1 minute, 35 cycles at 94°C for 30 seconds, 55°C for 1 minute, 68°C for 2 minutes and a final extension at 72°C for 5 minutes. The reaction volume was 30 μL and consisted of 20 ng of genomic DNA, 2 μL of 10× PCR buffer, 2 μL of 200 μM dNTP, 2 μL each of forward and reverse primer, and 0.5 units of Taq polymerase (TaKaRa Bio Inc.). Amplifications were examined using a gel electrophoresis in a 1% agarose gel and the amplified ITS region products were purified using a QIAquick Gel Extraction Kit (Qiagen). The PCR products were moved to the Macrogen Sequencing Service for sequencing (Macrogen, Seoul, Korea). The PCR primers were also used for sequencing. In the sequences for the ITS, the rbcL region were aligned using BioEdit (Hall 1999). Phylogenetic analyses were performed using the maximum- likelihood (ML) method. The bootstrap values were calculated with 1,000 replications. ITS sequences of other species were obtained from GenBank. Umbraulva japonica was used as an outgroup.

RESULTS AND DISCUSSION

Ulva torta (Mertens) Trevisan 1841: 480

Type locality: Norderney, East Frisian Islands, Germany

Korean name: Sil-gal-pa-rae nom. nov. (신칭: 실갈파래)

Specimens examined: MGARB012127, MGARB012128, MGARB012129, MGARB012130 (Imgok, 7 April 2017)

Habitat: Epilithic near the intertidal zone

Morphology: Thalli 5-10 cm high, 1-8 mm wide (Fig. 1A, B), distromatic, filiform to strap compressed or tubular (Fig. 1A-C), branched near the base (Fig. 1A, B) but without proliferations, light green to green in color; branches slightly tapered, with a uniseriate apex in the juvenile stage (Fig. 1D); vegetative cells rectangular to slightly round shape in the surface view (Fig. 1E), 10-40 μm×10-20 μm, longitudinally aligned in the younger part of the blade (Fig. 1F), disordered in the older part (Fig. 1G); each cell with a one cap-like parietal chloroplast bearing one or two pyrenoids (Fig. 1H, I).

Ulva torta was originally described from Norderney, East Frisian Islands, Germany (Silva et al. 1996). This species is widely distributed throughout the temperate regions of both hemispheres (Guiry and Guiry 2017), and its morphological variation is common, particularly under certain conditions, such as in brackish water and on mud flats in estuaries (Polderman 1975; Burrows 1991). According to some authors (Bliding 1963; Koeman and van den Hoek 1984; Brodie et al. 2007), it is characterized by very narrow unbranched filaments of similar diameter (mostly 25-50 μm) and longitudinal alignment of cells throughout the thallus. However, Ogawa et al. (2013) reported highly branched thalli and disordered cells in older plants of the species from Japan. Ulva clathratioides L.G. Kraft, Kraft et R.F. Waller, which was recently described from Australia (Kraft et al. 2010) but is genetically assignable to U. torta (Kirkendale et al. 2013; the present study), also shows a densely branched main axis (Kraft et al. 2010). In our specimens, many branches are found near the base of the thallus, but they lack proliferations (Fig. 1A, B). It appears that the features are variable based on those observations. The resulting morphological delimitation for U. torta seems to be more or less unclear, as commented by Phillips et al. (2016, see p. 62). Considering these aspects, our specimens, which share many features in the gross morphology with some exceptions (Ogawa et al. 2013; Phillips et al. 2016; the present study), can be also referred to as U. torta.

According to Ogawa et al. (2013), U. torta is very similar to U. clathrata (Roth) C. Agardh from Fehmarn, SW Baltic in morphology. However, it has been known by the molecular analysis based on ITS and rbcL sequences that both species nest in different clades with interspecific genetic distance, respectively (Ogawa et al. 2013; Kirkendale et al. 2013; the present study). It is also similar to U. clathratioides from Australia (Ogawa et al. 2013).

In general, the ITS and rbcL regions have been used to analyze the molecular phylogeny in Ulva (Malta et al. 1999; Hayden et al. 2003; Hayden and Waaland 2004; Hofmann et al. 2010; O’Kelly et al. 2010). In a phylogenetic tree based on molecular data (Figs. 2, 3), our specimens nested in the same clade with U. torta and U. clathratioides from Australia, but formed a sister clade to U. torta from Japan. In this group supported by the tubular filiform thallus normally without proliferations, the genetic distance between our Korean specimens and U. torta from Australia and Japan ranged from 0.01% to 0.2%. The genetic divergence value between U. clathratioides and U. torta (from Australia and Japan) was also calculated as 0.01-0.2%.

According to Lee et al. (2014), the interspecific genetic distance is 2.1-13.3% in Ulva. The current study demonstrated that the divergence range varies from 1.2% to 21.9%. These suggest that U. clathratioides should be reduced to a synonym of U. torta. However, the name is accepted until its evidence based on molecular data of U. torta from the type locality (Germany) is obtained. In addition, this result leads to a conclusion that our Korean specimens are identified as U. torta based on the morphological and molecular data. This investigation is the first record of U. torta in the Korean marine algal flora.