Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 1226-9999(Print)
ISSN : 2287-7851(Online)
Korean Journal of Environmental Biology Vol.35 No.3 pp.329-334
DOI : https://doi.org/10.11626/KJEB.2017.35.3.329

First Record of Ulva torta (Ulvales, Chlorophyta) in Korea

Jae Woo An
, Ki Wan Nam
*
Department of Marine Biology, Pukyong National University, Busan 48513, Republic of Korea
Corresponding author : Ki Wan Nam, 051-629-5922, 051-629-5922, kwnam@pknu.ac.kr
August 20, 2017 September 8, 2017 September 11, 2017

Abstract

A marine ulvalean species (Chlorophyta) was collected from Imgok, which is located on the eastern coast of Korea. This species is morphologically characterized by distromatic, filiform to strap compressed or tubular thallus. Many branches were found near the base, but lacked proliferations. Cells were longitudinally aligned in the younger part of the branch and were disordered in the older part of the branch. A cap-like parietal chloroplast with one or two pyrenoids was contained in each cell. In a phylogenetic tree based on ITS and rbcL sequences, this species was nested in the same clade as Ulva torta and U. clathratioides from Australia, but formed a sister clade to U. torta from Japan. However, the genetic divergence between them was included in an intraspecific variation range within Ulva. This finding suggests that U. clathratioides should be reduced to a synonym of U. torta. Accordingly, the Korean alga was identified as U. torta based on the morphological and molecular data. This investigation is the first record of U. torta in the Korean marine algal flora.


초록


    Ministry of Environment
    NIBR201701204

    INTRODUCTION

    Green marine algal genus Ulva Linnaeus (Ulvales) is a commonly abundant inhabitant of marine, estuarine and freshwater habitats worldwide and often causes harmful blooms in eutrophic estuaries and bays (Fletcher 1996). About 120 species are currently accepted in this genus (Guiry and Guiry 2017). Those species exhibit a simple thallus structure along with a lack of differentiated reproductive organs (Bliding 1963, 1968; Womersley 1984; Phillips 1988; Blomster et al. 1998, 1999; Hayden and Waaland 2004), which makes it difficult to identify the species. Moreover, the taxonomy of the genus is further complicated by the significant intraspecific variation and interspecific overlap in the relatively few morphological and anatomical characters that occurred in response to the varying conditions of the habitat environments (Tanner 1979, 1986; Phillips 1988; Malta et al. 1999).

    For these, the molecular data, such as the nuclear internal transcribed spacer (ITS) and plastid ribulose-1, 5-bisphosphate carboxylase/oxygenase (rbcL), have been used to delineate the species within the genus and phylogenetic analyses (Blomster et al. 1998, 1999; Shimada et al. 2008; Hofmann et al. 2010; Mares et al. 2011; Ogawa et al. 2013).

    Seventeen species in Ulva are currently recorded in the marine algal flora of Korea (Lee and Kang 1986, 2002; Lee 2008; Bae 2010; Kim et al. 2013; Lee et al. 2014). During a survey of marine algal flora, a species of Ulva was collected from Imgok, which is located on the eastern coast of Korea. Based on morphological and molecular analyses conducted in the current study, it was identified as U. torta which is a newly recorded in marine algal flora of Korea.

    MATERIALS AND METHODS

    For the current study, samples were collected from Imgok, which is on the eastern coast of Korea. A part of the samples was preserved in 5% formalin seawater, and the others were made as herbarium specimens. A portion of the material was dried, and preserved in silica gel for DNA extraction. Sections of the thallus were mounted in 30% corn syrup for permanent preparation. The extraction of total genomic DNA was made by using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the usual protocol. The extracted DNA was assessed by using a gel electrophoresis on a 1% agarose gel and used for amplification of the internal transcribed spacer (ITS) and Ribulose-1, 5-bisphosphate carboxylase/oxygenase (rbcL) regions by means of published primers (Ogawa et al. 2013). The primer sequences were as follows: ITS primer (F: 5′ TCTTTGAAACCG TATCGTGA 3′ R: 5′ GGTGAACCTGCGGAGGGAT 3′) and rbcL primer (F: 5′ TGTTTACGAGGTGGTCTTGA 3′, R: 5′ TCAAGACCACCTCGTAAACA 3′) (Hayakawa et al. 2012). PCR amplifications were performed in a TaKaRa PCR Thermal Cycler Dice (TaKaRa Bio Inc., Otsu, Japan) with an initial denaturation step at 94°C for 1 minute, 35 cycles at 94°C for 30 seconds, 55°C for 1 minute, 68°C for 2 minutes and a final extension at 72°C for 5 minutes. The reaction volume was 30 μL and consisted of 20 ng of genomic DNA, 2 μL of 10× PCR buffer, 2 μL of 200 μM dNTP, 2 μL each of forward and reverse primer, and 0.5 units of Taq polymerase (TaKaRa Bio Inc.). Amplifications were examined using a gel electrophoresis in a 1% agarose gel and the amplified ITS region products were purified using a QIAquick Gel Extraction Kit (Qiagen). The PCR products were moved to the Macrogen Sequencing Service for sequencing (Macrogen, Seoul, Korea). The PCR primers were also used for sequencing. In the sequences for the ITS, the rbcL region were aligned using BioEdit (Hall 1999). Phylogenetic analyses were performed using the maximum- likelihood (ML) method. The bootstrap values were calculated with 1,000 replications. ITS sequences of other species were obtained from GenBank. Umbraulva japonica was used as an outgroup.

    RESULTS AND DISCUSSION

    Ulva torta (Mertens) Trevisan 1841: 480

    Type locality: Norderney, East Frisian Islands, Germany

    Korean name: Sil-gal-pa-rae nom. nov. (신칭: 실갈파래)

    Specimens examined: MGARB012127, MGARB012128, MGARB012129, MGARB012130 (Imgok, 7 April 2017)

    Habitat: Epilithic near the intertidal zone

    Morphology: Thalli 5-10 cm high, 1-8 mm wide (Fig. 1A, B), distromatic, filiform to strap compressed or tubular (Fig. 1A-C), branched near the base (Fig. 1A, B) but without proliferations, light green to green in color; branches slightly tapered, with a uniseriate apex in the juvenile stage (Fig. 1D); vegetative cells rectangular to slightly round shape in the surface view (Fig. 1E), 10-40 μm×10-20 μm, longitudinally aligned in the younger part of the blade (Fig. 1F), disordered in the older part (Fig. 1G); each cell with a one cap-like parietal chloroplast bearing one or two pyrenoids (Fig. 1H, I).

    Ulva torta was originally described from Norderney, East Frisian Islands, Germany (Silva et al. 1996). This species is widely distributed throughout the temperate regions of both hemispheres (Guiry and Guiry 2017), and its morphological variation is common, particularly under certain conditions, such as in brackish water and on mud flats in estuaries (Polderman 1975; Burrows 1991). According to some authors (Bliding 1963; Koeman and van den Hoek 1984; Brodie et al. 2007), it is characterized by very narrow unbranched filaments of similar diameter (mostly 25-50 μm) and longitudinal alignment of cells throughout the thallus. However, Ogawa et al. (2013) reported highly branched thalli and disordered cells in older plants of the species from Japan. Ulva clathratioides L.G. Kraft, Kraft et R.F. Waller, which was recently described from Australia (Kraft et al. 2010) but is genetically assignable to U. torta (Kirkendale et al. 2013; the present study), also shows a densely branched main axis (Kraft et al. 2010). In our specimens, many branches are found near the base of the thallus, but they lack proliferations (Fig. 1A, B). It appears that the features are variable based on those observations. The resulting morphological delimitation for U. torta seems to be more or less unclear, as commented by Phillips et al. (2016, see p. 62). Considering these aspects, our specimens, which share many features in the gross morphology with some exceptions (Ogawa et al. 2013; Phillips et al. 2016; the present study), can be also referred to as U. torta.

    According to Ogawa et al. (2013), U. torta is very similar to U. clathrata (Roth) C. Agardh from Fehmarn, SW Baltic in morphology. However, it has been known by the molecular analysis based on ITS and rbcL sequences that both species nest in different clades with interspecific genetic distance, respectively (Ogawa et al. 2013; Kirkendale et al. 2013; the present study). It is also similar to U. clathratioides from Australia (Ogawa et al. 2013).

    In general, the ITS and rbcL regions have been used to analyze the molecular phylogeny in Ulva (Malta et al. 1999; Hayden et al. 2003; Hayden and Waaland 2004; Hofmann et al. 2010; O’Kelly et al. 2010). In a phylogenetic tree based on molecular data (Figs. 2, 3), our specimens nested in the same clade with U. torta and U. clathratioides from Australia, but formed a sister clade to U. torta from Japan. In this group supported by the tubular filiform thallus normally without proliferations, the genetic distance between our Korean specimens and U. torta from Australia and Japan ranged from 0.01% to 0.2%. The genetic divergence value between U. clathratioides and U. torta (from Australia and Japan) was also calculated as 0.01-0.2%.

    According to Lee et al. (2014), the interspecific genetic distance is 2.1-13.3% in Ulva. The current study demonstrated that the divergence range varies from 1.2% to 21.9%. These suggest that U. clathratioides should be reduced to a synonym of U. torta. However, the name is accepted until its evidence based on molecular data of U. torta from the type locality (Germany) is obtained. In addition, this result leads to a conclusion that our Korean specimens are identified as U. torta based on the morphological and molecular data. This investigation is the first record of U. torta in the Korean marine algal flora.

    ACKNOWLEDGEMENT

    This work was supported by a grant from the Marine Biotechnology Program (20170431) funded by the Ministry of Oceans and Fisheries, Korea, and by a grant from the National Institute of Biological Resources (NIBR) funded by the Ministry of Environment (MOE) of the Republic of Korea (NIBR201701204).

    Figure

    KJEB-35-329_F1.gif

    Ulva torta (Mertens) Trevisan. (A) Herbarium specimen (MGARB012127); (B) Habit of the vegetative plant in a liquid-preserved specimen; (C) Cross-section of the blade with a tubular form; (D) A juvenile branch with a uniseriate apex (arrow); (E) Surface view of the vegetative cells with rectangular to slightly round shape (arrows); (F) Surface view of the vegetative cells with longitudinal alignment in the younger part of the blade; (G) Surface view of the vegetative cells with a disordered alignment in the older part; (H) Surface view of a cap-like parietal chloroplast (arrow); (I) Surface view of the vegetative cells with one or two pyrenoid (arrows) per chloroplast.

    KJEB-35-329_F2.gif

    Phylogenetic tree of the selected taxa obtained from a maximum- likelihood analysis based on ITS sequences. The bootstrap percentages (1000 replicates samples) are displayed above the branches. Scale bar=0.02 substitutions/site.

    KJEB-35-329_F3.gif

    Phylogenetic tree of the selected taxa obtained from a maximum- likelihood analysis based on rbcL sequences. The bootstrap percentages (1000 replicates samples) are displayed above the branches. Scale bar=0.02 substitutions/ site.

    Table

    Reference

    1. Bae E.H. Bae E.H. , Kim HS , Kwon CJ (2010) Algal Flora of Korea., National Institute of Biological Resources, Vol.1 (1)
    2. Bliding C. (1963) A critical survey of European taxa in Ulvales. Part I. Capsosiphon, Percursaria, Blidingia, Enteromorpha. , Op. Bot. Soc. Bot. Lund., Vol.8 ; pp.1-160
    3. Bliding C. (1968) A critical survey of European taxa in Ulvales. II. Ulva, Ulvaria, Monostroma, Kornmannia. , Bot. Notiser., Vol.121 ; pp.535-629
    4. Blomster J. , Maggs C.A. , Stanhope M.J. (1998) Molecular and morphological analysis of Enteromorpha intestinalis and E. compressa (Chlorophyta) in the British Isles. , J. Phycol., Vol.34 ; pp.319-340
    5. Blomster J. , Maggs C.A. , Stanhope M.J. (1999) Extensive intraspecific morphological variation in Enteromorpha muscoides (Chlorophyta) revealed in molecular analysis. , J. Phycol., Vol.35 ; pp.575-586
    6. Brodie J. , Maggs C.A. , John D.M. (2007) The Green Seaweeds of Britain and Ireland., British Phycological Society,
    7. Burrows EM. (2007) Seaweeds of the British Isles. Volume 2. Chlorophyta., Natural History Museum Publications,
    8. Fletcher R.L. Schramm W. , Nienhuis P.H. (1996) Marine Benthic Vegetation. Recent Changes and the Effects of Eutrophication., Springer, ; pp.7-43
    9. Guiry M.D. , Guiry G.M. (2017) AlgaeBase. World-wide electronic publication., National University of Ireland, http://www.algaebase.org
    10. Hall T.A. (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. , Nucleic Acids Symp. Ser., Vol.41 ; pp.95-98
    11. Hayakawa Y. , Ogawa T. , Yoshikawa S. , Ohki K. , Kamiya M. (2012) Genetic and ecophysiological diversity of Cladophora (Cladophorales, Ulvophyceae) in various salinity regimes. , Phycol. Res., Vol.60 ; pp.86-97
    12. Hayden H.S. , Blomster J. , Maggs C.A. , Silva P.C. , Stanhope M.J. , Waaland J.R. (2003) Linnaeus was right all along: Ulva and Enteromorpha are not distinct genera. , Eur. J. Phycol., Vol.38 ; pp.277-294
    13. Hayden H.S. , Waaland J.R. (2004) A molecular systematic study of Ulva (Ulvaceae, Ulvales) from the northeast Pacific. , Phycologia, Vol.43 ; pp.364-382
    14. Hofmann L.C. , Nettleton J.C. , Neefus C.D. , Mathieson A.C. (2010) Cryptic diversity of Ulva (Ulvales, Chlorophyta) in the Great Bay Estuarine System (Atlantic USA): introduced and indigenous distromatic species. , Eur. J. Phycol., Vol.45 ; pp.230-239
    15. Kim H.S. , Boo S.M. , Lee I.K. , Sohn C.H. (2013) National List of Species of Korea, Marine Algae., Jeonghaengsa,
    16. Kirkendale L. , Saunders G.W. , Winberg P. (2013) A molecular survey of Ulva (Chlorophyta) in temperate Australia reveals enhanced levels of cosmopolitanism. , J. Phycol., Vol.49 ; pp.69-81
    17. Koeman R.P. , Van Den Hoek C. (1984) The taxonomy of Enteromorpha Link, 1820, (Chlorophyceae) in the Netherlands. 111. The sections Flexuosa and Clathratae and an addition to the section Profilerae. , Cryptogam., Algol., Vol.5 ; pp.21-61
    18. Kraft L.G. , Kraft G.T. , Waller R.F. (2010) Investigations into southern Australian Ulva (Ulvophyceae, Chlorophyta) taxonomy and molecular phylogeny indicate both cosmopolitanism and endemic cryptic species. , J. Phycol., Vol.46 ; pp.1257-1277
    19. Lee I.K. , Kang J.W. (1986) A check list of marine algae in Korea. , Kor. J. Phycol., Vol.1 ; pp.311-325
    20. Lee S.H. , Kang P.J. , Nam K.W. (2014) New record of two marine ulvalean species (Chlorophyta) in Korea. , J. Ecol. Environ., Vol.37 ; pp.379-358
    21. Lee Y.P. (2008) Marine Algae of Jeju., Academy Publishing Co,
    22. Lee Y.P. , Kang S.Y. (2002) A Catalogue of the Seaweeds in Korea., Jeju National University Press,
    23. Malta E.J. , Draisma S.G. , Kamermans P. (1999) Free-floating Ulva in the southwest Netherlands: Species or morphotypes? A morphological, molecular and ecological comparison. , Eur. J. Phycol., Vol.34 ; pp.443-454
    24. Mares J. , Leskinen E. , Sitkowska M. , Skacelova O. , Blomster J. (2011) The identity of European freshwater Ulva (Chlorophyta, Ulvophyceae) revealed by a combined molecular and morphological approach. , J. Phycol., Vol.47 ; pp.1177-1192
    25. Ogawa T. , Ohki K. , Kamiya M. (2013) Differences of spatial distribution and Seasonal succession among Ulva species (Ulvophyceae) across salinity gradients. , Phycologia, Vol.52 ; pp.637-651
    26. O’Kelly C.J. , Kurihara A. , Shipley T.C. , Sherweed A.R. (2010) Molecular assessment of Ulva spp. (Ulvophyceae, Chlorophyta) in the Hawaiian Islands. , J. Phycol., Vol.46 ; pp.728-735
    27. Phillips J.A. (1988) Field, anatomical and developmental studies on southern Australian species of Ulva (Ulvaceae, Chlorophyta). , Aust. Syst. Bot., Vol.1 ; pp.411-456
    28. Phillips J.A. , Lawton R.J. , Denys R. , Paul N.A. , Carl C. (2016) Ulva sapora sp. nov., an abundant tubular species of Ulva (Ulvales) from the tropical Pacific Ocean. , Phycologia, Vol.55 ; pp.55-64
    29. Polderman P.J. (1975) Some notes on the algal vegetation of two brackish polders on Texel (The Netherlands). , Hydrobiol. Bull., Vol.9 ; pp.23-34
    30. Shimada S. , Yokoyama N. , Arai S. , Hiraoka M. (2008) Phylogeography of the genus Ulva (Ulvophyceae, Chlorophyta), with special reference to the Japanese freshwater and brackish taxa. , J. Appl. Phycol., Vol.20 ; pp.979-989
    31. Silva P.C. , Basson P.W. , Moe R.L. (1996) Catalogue of the benthic marine algae of the Indian Ocean. , Univ. Calif. Publ. Bot., Vol.79 ; pp.1-1259
    32. Tanner C.E. (1979) The taxonomy and morphological variation of distromatic Ulvaceous algae (Chlorophyta) from the northeast Pacific. PhD thesis, University of British Columbia,
    33. Tanner C.E. (1986) Investigations of the taxonomy and morphological variation of Ulva (Chlorophyta): Ulva californica Wille. , Phycologia, Vol.25 ; pp.510-520
    34. Trevisan VBA (1842) Sul geuere Bangia. , Atti della Terza Riunione degli Scienziati italiani, Vol.1841 ; pp.478-481
    35. Womersley H.B. (1984) The Marine Benthic Flora of Southern Australia., Part I. Government Printer,